Login

What is DNA? - Structure, Overview

Instructor: Jeffrey Sack

Jeff is a Biology teacher and has a Doctorate in Educational Leadership

This lesson will explore the race to find the structure of the DNA molecule, the parts of that structure and how they fit together, and how this knowledge has been used to advance mankind.

Background

Did you know that you share many similarities with monkeys, fruit flies, ostriches, great white sharks, and even worms and bacteria? At first glance it may not appear as if these creatures have anything in common. However, if you examine their molecular components, you will see that all of these organisms are actually distant cousins of each other.

In 1953, there was a race within the scientific community to discover the structure of the DNA molecule. At this point, it was known that DNA carried the genetic code, or all the instructions a cell needs to make proteins and enzymes, but it was unclear what it looked like. Knowing what this genetic molecule looked like would provide much insight into how it worked because in biology, structure and function are very closely related. While many researchers around the world were investigating, the discovery was made by a team from King's College in London. Englishman Francis Crick and American James Watson, along with the assistance of Rosalind Franklin and Maurice Wilkins, figured out what the DNA molecule looked like by using, surprisingly enough, a model building kit!

The story goes that Rosalind Franklin, who was an x-ray crystallographer, had taken a picture of the DNA molecule, but didn't know what it was. One day, Watson happened to be in her lab and stumbled across the picture. He knew right away exactly what he was looking at. He returned to his lab and he and Crick started to put together a 3-D model that showed what DNA looked like. This structure came to be known as a double helix.

Structure of DNA

The double helix looks like a ladder that has been twisted at both ends. It is made of three component parts; a sugar, phosphate groups, and nitrogen bases. The sugar that makes up the backbone of the DNA molecule is called deoxyribose. It is a 5-carbon sugar that is interspersed with the phosphate groups, forming a repeating pattern. A phosphate group is a functional group (a compound that gives a carbon chain or ring a particular function) made up of phosphorous attached to four oxygen molecules.

The nitrogen bases are nitrogen bearing compounds, and those found in the DNA molecule are called adenine, guanine, thymine, and cytosine (A, G, T, and C for short). Adenine and guanine are called purines because they have a double carbon ring. Cytosine and thymine are called pyrimidines and have a single carbon ring (see Figure 1). When combined, each of these three parts makes a structure called a nucleotide, which is the monomer, or component part, of all nucleic acids. The sugar and phosphate groups make up the 'backbone' of the ladder and the 'rungs' are where the nitrogen bases are located.

Figure 1. The Shape of Nitrogen Bases
Nitrogen base structure

Prior to Watson and Crick's discovery of the structure of the DNA molecule, another scientist named Erwin Chargraff determined that the amount of adenine was equal to the amount of thymine and that the amount of cytosine was equal to the amount of guanine. Called Chargraff's rule, this relationship allows for what is called complementary base pairing. Due to the shape of each of these nitrogen bases, adenine can only pair with thymine and cytosine can only pair with guanine.

To show Chargraff's rules, consider the following random sequence of nitrogen bases from a DNA strand:

TTATGGCCGATATATAACCG

Since adenine has to bond with thymine and cytosine has to bond with guanine, the complementary strand, or the other half of this piece of DNA would be:

AATACCGGCTATATATTGGC

Figure 2 shows the twisted ladder structure of the double helix and how the nitrogen bases align with each other. The phosphate groups link the deoxyribose molecules together and the strands are held together with hydrogen bonds. Notice that the strands run in opposite directions. One end of each strand is called the 3' (Three Prime) end and the other end is called the 5' (Five Prime). This is important to consider when the DNA copies itself during cell division.

Figure 2. The Double Helix
DNA structure diagram

The Genetic Code

DNA is referred to as the genetic molecule. A gene is a segment of DNA that is responsible for the physical characteristics of an organism. This means that DNA carries all the instructions needed to make up all the genes, or genome, and in turn, produce all the traits of an organism. Genes make up about two percent of the total DNA in a person's genome. It is the sequence of the nitrogen bases that ultimately produces the traits you express, or your phenotype. For example, brown hair, blue eyes, and Alzheimer's disease are all traits caused by genes. While there are millions of base pairs in your DNA, not all of them will show traits. It turns out that those genes that show traits, called exons, are interspersed with non-showing sequences called introns. During the creation of proteins (the process that is needed to show your traits), the introns are removed so that the exons can be activated to show the traits.

The Human Genome Project

As technology has advanced, more and more studies into the structure of the DNA molecule have been completed. Because of these studies, it is now known that humans and chimpanzees share 99% of their DNA. This means that it is only a 1% difference in the genetic code that accounts for all the differences between you and a chimp! We humans have 99.9% the same DNA. Only 0.01% makes you different from me, from your brother, from your best friend, or from anyone else on the planet. That 0.01% also is what determines if you are going to develop Alzheimer's disease when you get older, or possibly develop cancer, or any number of other genetic diseases.

To unlock this lesson you must be a Study.com Member.
Create your account

Register for a free trial

Are you a student or a teacher?
I am a teacher

Unlock Your Education

See for yourself why 30 million people use Study.com

Become a Study.com member and start learning now.
Become a Member  Back

Earning College Credit

Did you know… We have over 95 college courses that prepare you to earn credit by exam that is accepted by over 2,000 colleges and universities. You can test out of the first two years of college and save thousands off your degree. Anyone can earn credit-by-exam regardless of age or education level.

To learn more, visit our Earning Credit Page

Transferring credit to the school of your choice

Not sure what college you want to attend yet? Study.com has thousands of articles about every imaginable degree, area of study and career path that can help you find the school that's right for you.

Create an account to start this course today
Try it free for 5 days!
Create An Account
Support