Polynucleotides are very important and giant molecules that constitute life. The polynucleotide is a polymer molecule consisting of nucleotides as its monomer units. There are two types of polynucleotides (also known as nucleic acid) that are found in nature. They are ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). DNA is the genetic material in all living cells. Both DNA and RNA differ in their composition, structure, and function. The building blocks of DNA and RNA are nucleotides that consist of the following components:
Nitrogenous bases are nitrogen-containing heterocyclic, planar aromatic molecules. DNA and RNA are composed of two families of nitrogenous bases namely purine and pyrimidine.
Purine: Purines contain two cyclic rings wherein a five-membered ring is fused to the six-membered ring. Nitrogenous bases Guanine (G) and adenine (A) belong to the purine family.
Pyrimidine: Cytosine (C), thymine (T), and uracil (U) are examples of pyrimidines because they all are derived from a six-membered pyrimidine ring.
| Purines | Pyrimidines |
|---|---|
| 2 cyclic carbon-nitrogen rings | 1 cyclic carbon-nitrogen ring |
| Examples- Adenine (A), Guanine (G) | Examples- Cytosine (C), Thymine (T), Uracil (U) |
Two types of cyclic five-carbon (Pentose) sugar are present in nucleotides: (i) Ribose sugar (ii) Deoxyribose sugar. These sugars differ only in the absence of a 2'-OH group in deoxyribose sugar. DNA and RNA differ in their pentose sugar content, ribose sugar being solely part of RNA, whereas DNA contains deoxyribose sugar.
The phosphate group is attached to the sugar molecule in a nucleotide. A maximum of three phosphate groups can be attached.
A nucleotide molecule without the phosphate group is termed a nucleoside and several nucleotides are linked sequentially to form a polynucleotide.
 |
The polynucleotide is uniquely assembled to give it a stable structure and specific functions. The whole structure of a polynucleotide depends on the constitution of its nucleotides.
Nucleotides are phosphoric acid esters of nucleosides or nucleoside phosphate. Thus, the nucleotide consists of a pentose sugar attached to a phosphate group at its 5' carbon and attached to a nitrogen base (either A or G or C or T or U) through 1' carbon (C-1). Purines (A, G) attach to C-1 of sugar through their 9' nitrogen (N-9) whereas, for pyrimidine (C, T, U), attachment is via 1' nitrogen (N-1) to C-1 of sugar. The nucleotide can have one, two, or three phosphate groups designated as \alpha, \beta, and \gamma for the first, second, and third phosphate from 5' carbon of sugar respectively.
Polynucleotides or nucleic acids are formed by the condensation reaction of two or more nucleotides with the elimination of pyrophosphate molecules. The nucleotides in the polynucleotide are covalently linked through a phosphodiester bond which joins the 5' phosphate of one nucleotide to the 3'-OH group of the adjacent nucleotide. Notably, in the polynucleotide, nucleotides are not joined covalently through nitrogenous bases instead it is alternating sugar and phosphate linkage that forms the backbone of the polynucleotide. Thus, with the sugar-phosphate backbone, different types of bases are attached to every sugar molecule throughout the length of the polynucleotide. A polynucleotide is read by the sequence of bases it contains. For example, a typical polynucleotide looks like this:
AATGGCCATTGACGCTCAGGTACGTACTTAAAGCTCGTCACGTAAGTCC
As a member, you'll also get unlimited access to over 88,000 lessons in math, English, science, history, and more. Plus, get practice tests, quizzes, and personalized coaching to help you succeed.
Get unlimited access to over 88,000 lessons.
Try it now
I would definitely recommend Study.com to my colleagues. It’s like a teacher waved a magic wand and did the work for me. I feel like it’s a lifeline.
As discussed above, the nucleotides are linked through a phosphodiester bond in a polynucleotide. The way in which the several nucleotide subunits are linked together in a polynucleotide is that it forms a chain-like structure. Interestingly, this chain of nucleotides gives DNA a chemical polarity or direction. In a DNA chain, all of the 3' and 5' groups of pentose sugar are involved in phosphodiester bonds except for the first and last nucleotide in the chain. The first nucleotide of the chain has an intact 5' phosphate group i.e. it is not bound to any other nucleotide and the last nucleotide has a free 3' hydroxyl group. Each DNA chain has polarity referred to as 5'end (where 5' carbon at one end of the molecule has a phosphate group) and 3'end (where 3' carbon at the other end of the molecule has a hydroxyl group). Thus, the nucleotides linked together in a polynucleotide chain give 3' and 5' ends.
The DNA molecule contains two polynucleotide chains wrapped together. The two polynucleotide strands of DNA are oriented in an antiparallel fashion. Phosphodiester bond which joins 5'carbon of one nucleotide to the 3'carbon of the adjacent nucleotide is oriented in opposite directions in two DNA strands. It means the 3'-OH terminus (3'end) of one strand is adjacent to the 5'-phosphate terminus (5'end) of the other. So, one strand runs in a 5' to 3' direction, and conversely, the other strand runs in a 3' to 5' direction.
In a cell, the polymerase enzyme performs the linking of nucleotides together to form a polynucleotide chain. Polymerase catalyzes the covalent phosphodiester bonds between sugar and phosphate. The reaction catalyzed by polymerases is known as polymerization reaction. In a polymerization reaction, the new incoming nucleotide attacks the 3'-OH group of sugar in the previous nucleotide via its 5' phosphate group. Such a reaction by the polymerase forms the phosphodiester bond between sugar and phosphate thus growing the polynucleotide chain in a 5' to 3' direction.
DNA and RNA are the two types of polynucleotide chains found in nature. DNA and RNA differ from each other in both structural and functional aspects. A DNA molecule is made up of two polynucleotide chains known as two strands coiled around each other. Thus, DNA has a double-stranded helical structure. Major features of DNA structure are listed below:
RNA on the contrary consists of a single polynucleotide chain and thus, has a single-stranded structure. RNA forms hairpins and loop structures. RNA utilizes uracil (U) as one of the pyrimidine bases instead of thymine (T). DNA and RNA have their respective polymerases namely DNA polymerase and RNA polymerase.
 |
Polynucleotides exhibit extremely important functions in the cell and are also called the molecules of life. DNA is the genetic material of the cell carrying all the instructions crucial for cellular function and survival. DNA also copies itself (through the process of DNA replication) and transmits the genetic information to the new cell formed during cell division. The genetic information stored in DNA is passed on to RNA (through the process of transcription) and then to proteins through the process of translation). There are three types of RNA with specific functions, namely: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA). mRNA and tRNA participate in the process of protein synthesis while rRNA forms the part of ribosomes.
Comparative detail of DNA and RNA is represented below:
| Features | DNA | RNA |
|---|---|---|
| Abbreviation | Deoxyribonucleic acid | Ribonucleic acid |
| Pentose sugar | Deoxyribose | Ribose |
| Base composition | Adenine (A) Guanine (G) Cytosine (C) Thymine (T) | Adenine (A) Guanine (G) Cytosine (C) Uracil (U) |
| Base pairing | A::T (Double hydrogen bonds) G:::C (Triple hydrogen bonds) | A::U (Double hydrogen bonds) G:::C (Triple hydrogen bonds) |
| Number of strands | Two strands | One strand |
| Polymerase | DNA polymerase | RNA polymerase |
| Structure | Antiparallel and helix | Hairpins and loops |
| Functions | Stores genetic information Participates in DNA replication and transcription | Participates in protein synthesis |
It is possible to synthesize a polynucleotide chain outside the cell using a polymerase chain reaction (PCR). The polymerase chain reaction is a chemical reaction used to synthesize and amplify a polynucleotide chain like DNA. PCR involves the following components:
The polynucleotide is a polymer molecule comprising nucleotides as its monomer units. Each nucleotide is composed of three components:
Purines- Adenine (A), Guanine (G)
Pyrimidines- Cytosine (C), Thymine (T; found only in DNA), Uracil (U; found only in RNA)
Deoxyribose sugar (found only in DNA)
Ribose sugar (found only in RNA)
A combination of the above three components yield the following molecules:
Polymerase enzyme catalyzes the formation of covalent phosphodiester bonds between sugar and phosphate of adjacent nucleotides and synthesizes the polynucleotide chain. Polymerase adds new nucleotides to the previous chain, thus growing the polynucleotide chain in a 5' to 3' direction.
DNA and RNA are two types of polynucleotide chains found in nature. Both differ in structural and functional aspects. DNA has double strands, antiparallel, and helical structure while RNA is single-stranded and possesses hairpin and loop structure. DNA is the genetic material that stores all the genetic information and instructions required by the cell. RNA is involved in the process of protein synthesis in the cell.
Apart from the cellular synthesis of polynucleotide chains by polymerases in the cell, it is possible to synthesize these chains outside the cell as well. A polymerase chain reaction (PCR) is used to copy and amplify a small amount of DNA or RNA. For PCR five components are required including, a template polynucleotide chain, DNA polymerase, primer, nucleotides mixture, and reaction buffer.
To unlock this lesson you must be a Study.com Member.
Create your account
A DNA polynucleotide is a polymer chain made up of several deoxynucleotides linked together. DNA polymerase is the enzyme responsible for synthesizing the DNA polynucleotide chain by linking individual nucleotides together.
A polynucleotide is a polymer composed of several nucleotides linked together. DNA and RNA are two types of polynucleotide molecules found in the cell. A polynucleotide chain has a sugar-phosphate backbone with nitrogen bases attached to every sugar molecule.
A nucleotide is the monomer unit of the polynucleotide. The polynucleotide is a long polymer chain while the nucleotide is a small molecule made up of nitrogen base, ribose sugar, and a phosphate group.
Already a member? Log In
Back
I would definitely recommend Study.com to my colleagues. It’s like a teacher waved a magic wand and did the work for me. I feel like it’s a lifeline.
