Science Courses / Course / Chapter

Polynucleotide Chain Structure & Overview

Sujata Kumari, Beth Skwarecki
  • Author
    Sujata Kumari

    Sujata Kumari has taught College level Biology and Biotechnology to undergraduate students for over 7 years. She has a doctorate (PhD) degree in the field of biosciences from Jawaharlal Nehru Centre for Advanced Scientific Research and Masters degree in Biotechnology from Madurai Kamaraj University. She also has certification from Government of India endorsing her eligibility for lectureship in colleges and universities.

  • Instructor
    Beth Skwarecki

    Beth has studied biology at the undergraduate level and biochemistry at the graduate level. Her specialties lie within biology, biotechnology, life sciences, genomics, bioinformatics, computational biology, and microbiology, among others. She has extensive experience as a health and science writer and has instruction experience at the college level.

Learn about polynucleotides. Understand what a polynucleotide is, how nucleotides are linked together to form a polynucleotide chain, explore its types and functions. Updated: 01/24/2022

Table of Contents

Show

What is a Polynucleotide?

Polynucleotides are very important and giant molecules that constitute life. The polynucleotide is a polymer molecule consisting of nucleotides as its monomer units. There are two types of polynucleotides (also known as nucleic acid) that are found in nature. They are ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). DNA is the genetic material in all living cells. Both DNA and RNA differ in their composition, structure, and function. The building blocks of DNA and RNA are nucleotides that consist of the following components:

  • Nitrogenous base (A base having a nitrogen atom)

Nitrogenous bases are nitrogen-containing heterocyclic, planar aromatic molecules. DNA and RNA are composed of two families of nitrogenous bases namely purine and pyrimidine.

Purine: Purines contain two cyclic rings wherein a five-membered ring is fused to the six-membered ring. Nitrogenous bases Guanine (G) and adenine (A) belong to the purine family.

Pyrimidine: Cytosine (C), thymine (T), and uracil (U) are examples of pyrimidines because they all are derived from a six-membered pyrimidine ring.

    Purines        Pyrimidines   
    2 cyclic carbon-nitrogen rings        1 cyclic carbon-nitrogen ring   
    Examples- Adenine (A), Guanine (G)        Examples- Cytosine (C), Thymine (T), Uracil (U)   

  • Pentose sugar (A five-carbon sugar)

Two types of cyclic five-carbon (Pentose) sugar are present in nucleotides: (i) Ribose sugar (ii) Deoxyribose sugar. These sugars differ only in the absence of a 2'-OH group in deoxyribose sugar. DNA and RNA differ in their pentose sugar content, ribose sugar being solely part of RNA, whereas DNA contains deoxyribose sugar.

  • Phosphate group

The phosphate group is attached to the sugar molecule in a nucleotide. A maximum of three phosphate groups can be attached.

A nucleotide molecule without the phosphate group is termed a nucleoside and several nucleotides are linked sequentially to form a polynucleotide.


Chemical structure of a nucleotide showing its components: Nitrogenous bases, a Pentose sugar and a Phosphate group.

Structure of a Nucleotide


Structure of Polynucleotides

The polynucleotide is uniquely assembled to give it a stable structure and specific functions. The whole structure of a polynucleotide depends on the constitution of its nucleotides.

Nucleotide structure

Nucleotides are phosphoric acid esters of nucleosides or nucleoside phosphate. Thus, the nucleotide consists of a pentose sugar attached to a phosphate group at its 5' carbon and attached to a nitrogen base (either A or G or C or T or U) through 1' carbon (C-1). Purines (A, G) attach to C-1 of sugar through their 9' nitrogen (N-9) whereas, for pyrimidine (C, T, U), attachment is via 1' nitrogen (N-1) to C-1 of sugar. The nucleotide can have one, two, or three phosphate groups designated as \alpha, \beta, and \gamma for the first, second, and third phosphate from 5' carbon of sugar respectively.

Polynucleotide structure

Polynucleotides or nucleic acids are formed by the condensation reaction of two or more nucleotides with the elimination of pyrophosphate molecules. The nucleotides in the polynucleotide are covalently linked through a phosphodiester bond which joins the 5' phosphate of one nucleotide to the 3'-OH group of the adjacent nucleotide. Notably, in the polynucleotide, nucleotides are not joined covalently through nitrogenous bases instead it is alternating sugar and phosphate linkage that forms the backbone of the polynucleotide. Thus, with the sugar-phosphate backbone, different types of bases are attached to every sugar molecule throughout the length of the polynucleotide. A polynucleotide is read by the sequence of bases it contains. For example, a typical polynucleotide looks like this:

AATGGCCATTGACGCTCAGGTACGTACTTAAAGCTCGTCACGTAAGTCC

How are Nucleotides Linked Together to Form a Polynucleotide Chain?

As discussed above, the nucleotides are linked through a phosphodiester bond in a polynucleotide. The way in which the several nucleotide subunits are linked together in a polynucleotide is that it forms a chain-like structure. Interestingly, this chain of nucleotides gives DNA a chemical polarity or direction. In a DNA chain, all of the 3' and 5' groups of pentose sugar are involved in phosphodiester bonds except for the first and last nucleotide in the chain. The first nucleotide of the chain has an intact 5' phosphate group i.e. it is not bound to any other nucleotide and the last nucleotide has a free 3' hydroxyl group. Each DNA chain has polarity referred to as 5'end (where 5' carbon at one end of the molecule has a phosphate group) and 3'end (where 3' carbon at the other end of the molecule has a hydroxyl group). Thus, the nucleotides linked together in a polynucleotide chain give 3' and 5' ends.

Antiparallel Orientation

The DNA molecule contains two polynucleotide chains wrapped together. The two polynucleotide strands of DNA are oriented in an antiparallel fashion. Phosphodiester bond which joins 5'carbon of one nucleotide to the 3'carbon of the adjacent nucleotide is oriented in opposite directions in two DNA strands. It means the 3'-OH terminus (3'end) of one strand is adjacent to the 5'-phosphate terminus (5'end) of the other. So, one strand runs in a 5' to 3' direction, and conversely, the other strand runs in a 3' to 5' direction.

Role of Polymerase

In a cell, the polymerase enzyme performs the linking of nucleotides together to form a polynucleotide chain. Polymerase catalyzes the covalent phosphodiester bonds between sugar and phosphate. The reaction catalyzed by polymerases is known as polymerization reaction. In a polymerization reaction, the new incoming nucleotide attacks the 3'-OH group of sugar in the previous nucleotide via its 5' phosphate group. Such a reaction by the polymerase forms the phosphodiester bond between sugar and phosphate thus growing the polynucleotide chain in a 5' to 3' direction.

Types of Polynucleotide Chains

DNA and RNA are the two types of polynucleotide chains found in nature. DNA and RNA differ from each other in both structural and functional aspects. A DNA molecule is made up of two polynucleotide chains known as two strands coiled around each other. Thus, DNA has a double-stranded helical structure. Major features of DNA structure are listed below:

  • In both, the strands of DNA, sugar-phosphate backbones are at the outer edge of the helix and the bases face inward towards the center of the helix (like steps of the circular staircase).
  • Both the strands interact with each other through hydrogen bonds between complementary base pairs.
  • Purine-pyrimidine base pairing holds both the strands together. Adenine always pairs with thymine in the opposite strand through two hydrogen bonds and vice versa. Similarly, hydrogen bonding is allowed between guanine and cytosine in opposite strands. Guanine and cytosine interact through three hydrogen bonds.
  • The two polynucleotide strands of DNA are oriented in an antiparallel fashion.

To unlock this lesson you must be a Study.com Member.
Create your account

Frequently Asked Questions

What is a DNA polynucleotide?

A DNA polynucleotide is a polymer chain made up of several deoxynucleotides linked together. DNA polymerase is the enzyme responsible for synthesizing the DNA polynucleotide chain by linking individual nucleotides together.

What is a polynucleotide chain?

A polynucleotide is a polymer composed of several nucleotides linked together. DNA and RNA are two types of polynucleotide molecules found in the cell. A polynucleotide chain has a sugar-phosphate backbone with nitrogen bases attached to every sugar molecule.

What is the difference between a nucleotide and polynucleotide?

A nucleotide is the monomer unit of the polynucleotide. The polynucleotide is a long polymer chain while the nucleotide is a small molecule made up of nitrogen base, ribose sugar, and a phosphate group.

Register to view this lesson

Are you a student or a teacher?

Unlock Your Education

See for yourself why 30 million people use Study.com

Become a Study.com member and start learning now.
Become a Member  Back

Resources created by teachers for teachers

Over 30,000 video lessons & teaching resources‐all in one place.
Video lessons
Quizzes & Worksheets
Classroom Integration
Lesson Plans

I would definitely recommend Study.com to my colleagues. It’s like a teacher waved a magic wand and did the work for me. I feel like it’s a lifeline.

Jennifer B.
Teacher
Jennifer B.
Create an account to start this course today
Used by over 30 million students worldwide
Create an account